Transcript: Mouse NM_133196.6

Mus musculus cleavage stimulation factor, 3' pre-RNA subunit 2 (Cstf2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Cstf2 (108062)
Length:
4542
CDS:
190..1932

Additional Resources:

NCBI RefSeq record:
NM_133196.6
NBCI Gene record:
Cstf2 (108062)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133196.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000102281 CCTGTCATAGAGTCACCTTAT pLKO.1 514 CDS 100% 10.800 7.560 N Cstf2 n/a
2 TRCN0000354087 CCTGTCATAGAGTCACCTTAT pLKO_005 514 CDS 100% 10.800 7.560 N Cstf2 n/a
3 TRCN0000102283 GCAAAGACAGAGTATCCTAAT pLKO.1 1872 CDS 100% 10.800 7.560 N Cstf2 n/a
4 TRCN0000326095 GCAAAGACAGAGTATCCTAAT pLKO_005 1872 CDS 100% 10.800 7.560 N Cstf2 n/a
5 TRCN0000102280 GCTGGCAACAAATCTGGAAAT pLKO.1 1948 3UTR 100% 10.800 7.560 N Cstf2 n/a
6 TRCN0000326166 GCTGGCAACAAATCTGGAAAT pLKO_005 1948 3UTR 100% 10.800 7.560 N Cstf2 n/a
7 TRCN0000278954 TGTTAGTTTCAGATTGGTATA pLKO_005 315 CDS 100% 10.800 7.560 N CSTF2 n/a
8 TRCN0000102284 GCTTTGATTATGCAGGTCCTT pLKO.1 1813 CDS 100% 2.640 1.848 N Cstf2 n/a
9 TRCN0000158299 CCAGACAAATATCCCAACGCT pLKO.1 768 CDS 100% 0.750 0.525 N CSTF2 n/a
10 TRCN0000102282 GCACAGGTAGTGATGAGAATT pLKO.1 712 CDS 100% 0.000 0.000 N Cstf2 n/a
11 TRCN0000326096 GCACAGGTAGTGATGAGAATT pLKO_005 712 CDS 100% 0.000 0.000 N Cstf2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133196.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.