Transcript: Mouse NM_133219.1

Mus musculus glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (Gcnt2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-01-19
Taxon:
Mus musculus (mouse)
Gene:
Gcnt2 (14538)
Length:
4021
CDS:
250..1455

Additional Resources:

NCBI RefSeq record:
NM_133219.1
NBCI Gene record:
Gcnt2 (14538)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133219.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000321200 ATACAGCCGAGCTGGTATTTC pLKO_005 1432 CDS 100% 13.200 18.480 N Gcnt2 n/a
2 TRCN0000321132 GACTTGCAGTGGCTGATTAAT pLKO_005 1303 CDS 100% 15.000 12.000 N Gcnt2 n/a
3 TRCN0000009754 GCCTCTTGAATGTCTATGATT pLKO.1 2726 3UTR 100% 5.625 3.938 N Gcnt2 n/a
4 TRCN0000321129 GCCTCTTGAATGTCTATGATT pLKO_005 2726 3UTR 100% 5.625 3.938 N Gcnt2 n/a
5 TRCN0000009756 GCTTCGAGAAAGAACACTCAA pLKO.1 1395 CDS 100% 4.950 3.465 N Gcnt2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133219.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.