Transcript: Mouse NM_133229.2

Mus musculus ripply transcriptional repressor 3 (Ripply3), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Ripply3 (170765)
Length:
1554
CDS:
76..534

Additional Resources:

NCBI RefSeq record:
NM_133229.2
NBCI Gene record:
Ripply3 (170765)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133229.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437112 CAACACACATCGGGATCAAAG pLKO_005 271 CDS 100% 10.800 15.120 N Ripply3 n/a
2 TRCN0000201125 CCGTTTCAAAGCGTCAAGAAT pLKO.1 332 CDS 100% 5.625 7.875 N Ripply3 n/a
3 TRCN0000437188 GCGAGAGCTCTAGCAAATGAA pLKO_005 608 3UTR 100% 5.625 7.875 N Ripply3 n/a
4 TRCN0000439517 CTCTTGTCCAGAGACCCATTT pLKO_005 960 3UTR 100% 10.800 7.560 N Ripply3 n/a
5 TRCN0000434684 TGTAGACGTTAACTCCCATTT pLKO_005 1009 3UTR 100% 10.800 7.560 N Ripply3 n/a
6 TRCN0000201317 GCATCCTGTCAGACTTTACTT pLKO.1 309 CDS 100% 5.625 3.938 N Ripply3 n/a
7 TRCN0000200666 GTCAAGAATACCTTCAGAGTT pLKO.1 344 CDS 100% 4.950 3.465 N Ripply3 n/a
8 TRCN0000190060 GAGATGCTGAACTGACCAGAA pLKO.1 221 CDS 100% 4.050 2.430 N Ripply3 n/a
9 TRCN0000201113 CCTGAGTTCAATTCTCAGCAA pLKO.1 1098 3UTR 100% 0.264 0.132 Y Ripply3 n/a
10 TRCN0000189814 GCCAGGAACTCCACTTTCTTT pLKO.1 753 3UTR 100% 5.625 3.375 N Ripply3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133229.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.