Transcript: Mouse NM_133251.2

Mus musculus vestigial like family member 1 (Vgll1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-02-27
Taxon:
Mus musculus (mouse)
Gene:
Vgll1 (170828)
Length:
2281
CDS:
264..1187

Additional Resources:

NCBI RefSeq record:
NM_133251.2
NBCI Gene record:
Vgll1 (170828)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133251.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000054579 CCAGAGGTCTACCATGTCTTT pLKO.1 885 CDS 100% 4.950 6.930 N Vgll1 n/a
2 TRCN0000054581 CAGTGACAATTTGACCCTCAA pLKO.1 452 CDS 100% 4.050 3.240 N Vgll1 n/a
3 TRCN0000054578 GCTTGGATGAATATGGTCTTA pLKO.1 685 CDS 100% 4.950 3.465 N Vgll1 n/a
4 TRCN0000054580 CCCACAAATGCAGTTCCTCAA pLKO.1 427 CDS 100% 4.050 2.835 N Vgll1 n/a
5 TRCN0000054582 CTTCAACATTTAGTCCAGCAA pLKO.1 957 CDS 100% 2.640 1.848 N Vgll1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133251.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.