Transcript: Human NM_133264.5

Homo sapiens WAS/WASL interacting protein family member 2 (WIPF2), mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
WIPF2 (147179)
Length:
7492
CDS:
259..1581

Additional Resources:

NCBI RefSeq record:
NM_133264.5
NBCI Gene record:
WIPF2 (147179)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_133264.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029830 CCCGCCTACAACAGAGAGAAA pLKO.1 859 CDS 100% 4.950 3.960 N WIPF2 n/a
2 TRCN0000029829 CCGGTCTTTCTTGGATGATTT pLKO.1 1425 CDS 100% 13.200 9.240 N WIPF2 n/a
3 TRCN0000318885 CCGGTCTTTCTTGGATGATTT pLKO_005 1425 CDS 100% 13.200 9.240 N WIPF2 n/a
4 TRCN0000029831 GCGCCCTCTTACAGGACATTT pLKO.1 371 CDS 100% 13.200 9.240 N WIPF2 n/a
5 TRCN0000318954 GCGCCCTCTTACAGGACATTT pLKO_005 371 CDS 100% 13.200 9.240 N WIPF2 n/a
6 TRCN0000029833 GCCACAGAGACACAATTCTTT pLKO.1 1086 CDS 100% 5.625 3.938 N WIPF2 n/a
7 TRCN0000318884 GCCACAGAGACACAATTCTTT pLKO_005 1086 CDS 100% 5.625 3.938 N WIPF2 n/a
8 TRCN0000029832 CAGAGGATATATCCCAGCAAA pLKO.1 1510 CDS 100% 4.950 3.465 N WIPF2 n/a
9 TRCN0000318886 CAGAGGATATATCCCAGCAAA pLKO_005 1510 CDS 100% 4.950 3.465 N WIPF2 n/a
10 TRCN0000183848 CACAATTCTTTGCATAGGAAA pLKO.1 1096 CDS 100% 4.950 3.465 N Wipf2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133264.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.