Transcript: Human NM_133334.2

Homo sapiens nuclear receptor binding SET domain protein 2 (NSD2), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
NSD2 (7468)
Length:
8390
CDS:
30..1973

Additional Resources:

NCBI RefSeq record:
NM_133334.2
NBCI Gene record:
NSD2 (7468)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_133334.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000019815 GCACGCTACAACACCAAGTTT pLKO.1 1527 CDS 100% 5.625 7.875 N NSD2 n/a
2 TRCN0000274233 ATCTTACTTCCCGGGTGTTTA pLKO_005 271 CDS 100% 13.200 9.240 N NSD2 n/a
3 TRCN0000019818 CCCAGAAAGAGCTTGGATATT pLKO.1 839 CDS 100% 13.200 9.240 N NSD2 n/a
4 TRCN0000274183 CCCAGAAAGAGCTTGGATATT pLKO_005 839 CDS 100% 13.200 9.240 N NSD2 n/a
5 TRCN0000274232 GATGAAGCAGGCACCAGAAAT pLKO_005 89 CDS 100% 13.200 9.240 N NSD2 n/a
6 TRCN0000019816 CCTCTCTTTGAATCTTCCATT pLKO.1 438 CDS 100% 4.950 3.465 N NSD2 n/a
7 TRCN0000019817 CGGAAAGCCAAGTTCACCTTT pLKO.1 1047 CDS 100% 4.950 3.465 N NSD2 n/a
8 TRCN0000274182 CGGAAAGCCAAGTTCACCTTT pLKO_005 1047 CDS 100% 4.950 3.465 N NSD2 n/a
9 TRCN0000218710 CCAGAAAGAGCTTGGATATTT pLKO_005 840 CDS 100% 15.000 9.000 N Nsd2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133334.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.