Transcript: Mouse NM_133363.3

Mus musculus myozenin 3 (Myoz3), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Myoz3 (170947)
Length:
3397
CDS:
27..764

Additional Resources:

NCBI RefSeq record:
NM_133363.3
NBCI Gene record:
Myoz3 (170947)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133363.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098456 CCGAGACTATCGCAACTTCAA pLKO.1 572 CDS 100% 4.950 6.930 N Myoz3 n/a
2 TRCN0000098459 GTTCACCAGCTACCAAGACTA pLKO.1 518 CDS 100% 4.950 6.930 N Myoz3 n/a
3 TRCN0000098457 GCAGAAGTTTACCTTTGAGCT pLKO.1 203 CDS 100% 2.640 3.696 N Myoz3 n/a
4 TRCN0000098458 CCTTTGAGCTATCAGAAAGTT pLKO.1 214 CDS 100% 5.625 3.375 N Myoz3 n/a
5 TRCN0000098455 CGGGTGCAGAAGTTTACCTTT pLKO.1 198 CDS 100% 4.950 2.970 N Myoz3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133363.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.