Transcript: Human NM_133369.3

Homo sapiens unc-5 netrin receptor A (UNC5A), mRNA.

Source:
NCBI, updated 2019-05-14
Taxon:
Homo sapiens (human)
Gene:
UNC5A (90249)
Length:
3733
CDS:
193..2721

Additional Resources:

NCBI RefSeq record:
NM_133369.3
NBCI Gene record:
UNC5A (90249)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_133369.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428264 GCCGGCTGATGATCCCTAATA pLKO_005 1547 CDS 100% 13.200 10.560 N UNC5A n/a
2 TRCN0000416520 TGGACCTTATGCAAACATTTC pLKO_005 3115 3UTR 100% 10.800 7.560 N UNC5A n/a
3 TRCN0000164505 CAAGAGTCAGAAGGCCTACAT pLKO.1 597 CDS 100% 4.950 3.465 N UNC5A n/a
4 TRCN0000160824 CATAGCCTATTTGCGCAAGAA pLKO.1 621 CDS 100% 4.950 3.465 N UNC5A n/a
5 TRCN0000163854 CCGAGGGAAGATCTATGAGAT pLKO.1 1605 CDS 100% 4.950 3.465 N UNC5A n/a
6 TRCN0000164021 CCTCGTTTATTGCCGGAAGAA pLKO.1 1164 CDS 100% 4.950 3.465 N UNC5A n/a
7 TRCN0000163182 GCAGAGCTTCAGCATCAACTT pLKO.1 2343 CDS 100% 4.950 3.465 N UNC5A n/a
8 TRCN0000164310 CGAGGATGTGTACATCGTCAA pLKO.1 342 CDS 100% 4.050 2.835 N UNC5A n/a
9 TRCN0000164360 CTGTGGAAGAGTAAGCTCCTT pLKO.1 2179 CDS 100% 2.640 1.584 N UNC5A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133369.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.