Transcript: Human NM_133432.3

Homo sapiens titin (TTN), transcript variant novex-1, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
TTN (7273)
Length:
82404
CDS:
226..81381

Additional Resources:

NCBI RefSeq record:
NM_133432.3
NBCI Gene record:
TTN (7273)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_133432.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246184 AGCCGGATTAACGGTTATAAA pLKO_005 81596 3UTR 100% 15.000 21.000 N TTN n/a
2 TRCN0000246183 CCGTAATACAGCTACAATTAA pLKO_005 57033 CDS 100% 15.000 21.000 N TTN n/a
3 TRCN0000195325 CCGTGTGTATGCCGTTAATAA pLKO.1 40095 CDS 100% 15.000 21.000 N TTN n/a
4 TRCN0000246182 GACGTCCCTGGACCTATTATA pLKO_005 49885 CDS 100% 15.000 21.000 N TTN n/a
5 TRCN0000246186 GTTCCGTGTTACAGCTATAAA pLKO_005 39786 CDS 100% 15.000 21.000 N TTN n/a
6 TRCN0000037483 CGCGCCTTACTTTATTACAAA pLKO.1 3327 CDS 100% 5.625 7.875 N TTN n/a
7 TRCN0000037481 CGCTGGATTAAATGCAACAAA pLKO.1 46207 CDS 100% 5.625 7.875 N TTN n/a
8 TRCN0000246185 TCCGTGTGTATGCCGTTAATA pLKO_005 40094 CDS 100% 15.000 10.500 N TTN n/a
9 TRCN0000194712 CAACACTTTGTTCGCTCATTT pLKO.1 81991 3UTR 100% 13.200 9.240 N TTN n/a
10 TRCN0000194767 CCTTATACTCTACACTCATTC pLKO.1 81394 3UTR 100% 10.800 7.560 N TTN n/a
11 TRCN0000037479 CGCCCAATAAAGGACTTGAAA pLKO.1 24118 CDS 100% 5.625 3.938 N TTN n/a
12 TRCN0000037482 GCCACCAAATTAGATGACATT pLKO.1 8125 CDS 100% 4.950 3.465 N TTN n/a
13 TRCN0000196828 GCTGTGCATATCACTTGATAT pLKO.1 81820 3UTR 100% 1.320 0.924 N TTN n/a
14 TRCN0000037480 GCCCAGAATAAATATGGCATT pLKO.1 29986 CDS 100% 4.050 2.430 N TTN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133432.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.