Transcript: Human NM_133477.3

Homo sapiens synaptopodin 2 (SYNPO2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Homo sapiens (human)
Gene:
SYNPO2 (171024)
Length:
7282
CDS:
184..3969

Additional Resources:

NCBI RefSeq record:
NM_133477.3
NBCI Gene record:
SYNPO2 (171024)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_133477.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000139658 CCAGACCCTAACTTGTCACAT pLKO.1 868 CDS 100% 4.950 6.930 N SYNPO2 n/a
2 TRCN0000139276 CCCATGAATAGAACGGCCAAA pLKO.1 1933 CDS 100% 4.050 5.670 N SYNPO2 n/a
3 TRCN0000141357 CCACGACTTCTTACCAAAGAA pLKO.1 1778 CDS 100% 0.563 0.788 N SYNPO2 n/a
4 TRCN0000142085 CAGTGGAATAAGTGAGGCTTT pLKO.1 447 CDS 100% 4.050 2.835 N SYNPO2 n/a
5 TRCN0000140276 GCAGGCTTTGTGTTACGTGTT pLKO.1 5226 3UTR 100% 4.050 2.835 N SYNPO2 n/a
6 TRCN0000142111 GAAGTCATCAAGCTCATGGAA pLKO.1 385 CDS 100% 3.000 2.100 N SYNPO2 n/a
7 TRCN0000145450 GCATCCTTGTTTACTTTCCAA pLKO.1 3103 CDS 100% 3.000 2.100 N SYNPO2 n/a
8 TRCN0000142435 GTTGTGAACTTTGACTGGGAT pLKO.1 1558 CDS 100% 2.640 1.848 N SYNPO2 n/a
9 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4765 3UTR 100% 5.625 2.813 Y KLHL30 n/a
10 TRCN0000148469 CTGGGTTCAAGCAATTCTCTT pLKO.1 4601 3UTR 100% 4.950 2.475 Y C16orf89 n/a
11 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4765 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133477.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.