Transcript: Human NM_133493.5

Homo sapiens CD109 molecule (CD109), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
CD109 (135228)
Length:
9031
CDS:
14..4351

Additional Resources:

NCBI RefSeq record:
NM_133493.5
NBCI Gene record:
CD109 (135228)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_133493.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073649 GCCGATCCTTACATAGATATT pLKO.1 3008 CDS 100% 13.200 18.480 N CD109 n/a
2 TRCN0000073651 CCGCTTATCATTTGAGACCAA pLKO.1 373 CDS 100% 2.640 3.696 N CD109 n/a
3 TRCN0000073650 CCCGGAGGAAATGTGACTATT pLKO.1 125 CDS 100% 13.200 9.240 N CD109 n/a
4 TRCN0000073652 GCAGCCCTAATGAATACAGAA pLKO.1 3596 CDS 100% 4.950 3.465 N CD109 n/a
5 TRCN0000073648 GCAGTACATTTACTGTGCTTT pLKO.1 4997 3UTR 100% 0.495 0.347 N CD109 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133493.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.