Transcript: Mouse NM_133500.2

Mus musculus netrin G2 (Ntng2), transcript variant a, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Ntng2 (171171)
Length:
1747
CDS:
60..1652

Additional Resources:

NCBI RefSeq record:
NM_133500.2
NBCI Gene record:
Ntng2 (171171)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133500.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094558 GCGTAACATGGACAACCTGTA pLKO.1 740 CDS 100% 4.050 5.670 N Ntng2 n/a
2 TRCN0000094554 CGGCTTATGTTTGACAGGGAA pLKO.1 336 CDS 100% 2.640 2.112 N Ntng2 n/a
3 TRCN0000094557 CCGTTGCAGCTACATTGACTT pLKO.1 1142 CDS 100% 4.950 3.465 N Ntng2 n/a
4 TRCN0000142293 GATGATGAGAACGTCTGCATT pLKO.1 1263 CDS 100% 4.950 3.465 N NTNG2 n/a
5 TRCN0000141598 CAGCTACATTGACTTCCTGAA pLKO.1 1148 CDS 100% 4.050 2.430 N NTNG2 n/a
6 TRCN0000094555 GCGCCTGAAGGATTATGTCAA pLKO.1 191 CDS 100% 4.950 2.475 Y Ntng2 n/a
7 TRCN0000094556 CCTGAAGGATTATGTCAAGGT pLKO.1 194 CDS 100% 2.640 1.320 Y Ntng2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133500.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.