Transcript: Mouse NM_133684.3

Mus musculus mitochondrial amidoxime reducing component 2 (Marc2), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Marc2 (67247)
Length:
1883
CDS:
31..1047

Additional Resources:

NCBI RefSeq record:
NM_133684.3
NBCI Gene record:
Marc2 (67247)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133684.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000173133 CTGTTTGGTCTCGACATCAAA pLKO.1 478 CDS 100% 5.625 7.875 N Marc2 n/a
2 TRCN0000251009 CAAGCTCCCTTCTTCGAATAA pLKO_005 441 CDS 100% 13.200 10.560 N Marc2 n/a
3 TRCN0000193695 CGCCTTGACTTAATTCAAGAA pLKO.1 1153 3UTR 100% 0.495 0.396 N Marc2 n/a
4 TRCN0000251007 GAAAGTGAAGATGGAATATTT pLKO_005 723 CDS 100% 15.000 10.500 N Marc2 n/a
5 TRCN0000258145 ATCACCCTGGAGAACAATTAC pLKO_005 376 CDS 100% 13.200 9.240 N Marc2 n/a
6 TRCN0000251008 TGAATGCTACACCCGCTATTA pLKO_005 1266 3UTR 100% 13.200 9.240 N Marc2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133684.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.