Transcript: Mouse NM_133686.1

Mus musculus quinolinate phosphoribosyltransferase (Qprt), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Qprt (67375)
Length:
1211
CDS:
45..944

Additional Resources:

NCBI RefSeq record:
NM_133686.1
NBCI Gene record:
Qprt (67375)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133686.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000093885 CGCCATCTTCACTCAACTCAA pLKO.1 227 CDS 100% 4.950 6.930 N Qprt n/a
2 TRCN0000093884 CGAAGAAGATGCCACCAGAAT pLKO.1 948 3UTR 100% 4.950 3.960 N Qprt n/a
3 TRCN0000093886 CCTGGTAATGCTGGACAACTT pLKO.1 695 CDS 100% 4.950 3.465 N Qprt n/a
4 TRCN0000093887 TCCCTCAAACTGTTTGCTGAA pLKO.1 888 CDS 100% 4.050 2.835 N Qprt n/a
5 TRCN0000093888 GCTGGACAACTTTAAGCCTGA pLKO.1 704 CDS 100% 2.160 1.512 N Qprt n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133686.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.