Transcript: Mouse NM_133716.3

Mus musculus small ArfGAP 2 (Smap2), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Smap2 (69780)
Length:
2923
CDS:
397..1683

Additional Resources:

NCBI RefSeq record:
NM_133716.3
NBCI Gene record:
Smap2 (69780)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133716.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000295673 TGAAGGATTTATTCGAGATAA pLKO_005 726 CDS 100% 13.200 18.480 N Smap2 n/a
2 TRCN0000295675 CGGTTTAGAAACTGATCATAA pLKO_005 1786 3UTR 100% 13.200 10.560 N Smap2 n/a
3 TRCN0000106198 CGACTCTATGAAGCCTACCTT pLKO.1 667 CDS 100% 3.000 2.400 N Smap2 n/a
4 TRCN0000295674 AGTCCTCAGATGTGGAAATAA pLKO_005 1663 CDS 100% 15.000 10.500 N Smap2 n/a
5 TRCN0000437478 TGGATCCCAGACGCCTCAAAT pLKO_005 1209 CDS 100% 13.200 9.240 N SMAP2 n/a
6 TRCN0000295676 ACCGAAGTCTGGACATCAATG pLKO_005 770 CDS 100% 10.800 7.560 N Smap2 n/a
7 TRCN0000413395 ACCGAAGTCTGGACATCAATG pLKO_005 770 CDS 100% 10.800 7.560 N SMAP2 n/a
8 TRCN0000106196 GCAAACAGTAAGACCAGCAAT pLKO.1 991 CDS 100% 4.950 3.465 N Smap2 n/a
9 TRCN0000288412 GCAAACAGTAAGACCAGCAAT pLKO_005 991 CDS 100% 4.950 3.465 N Smap2 n/a
10 TRCN0000106197 CCATCCTATCACTGTATGGAT pLKO.1 1193 CDS 100% 3.000 2.100 N Smap2 n/a
11 TRCN0000106199 GCCTACCTTCCCGAGACCTTT pLKO.1 679 CDS 100% 1.650 1.155 N Smap2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133716.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.