Transcript: Mouse NM_133740.2

Mus musculus protein arginine N-methyltransferase 3 (Prmt3), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Prmt3 (71974)
Length:
2495
CDS:
120..1706

Additional Resources:

NCBI RefSeq record:
NM_133740.2
NBCI Gene record:
Prmt3 (71974)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133740.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000097492 CCTACGGTTGAATATATGAAT pLKO.1 414 CDS 100% 5.625 7.875 N Prmt3 n/a
2 TRCN0000332236 CCTACGGTTGAATATATGAAT pLKO_005 414 CDS 100% 5.625 7.875 N Prmt3 n/a
3 TRCN0000097493 CCTCATTGTGACCCTGACTTT pLKO.1 1652 CDS 100% 4.950 3.465 N Prmt3 n/a
4 TRCN0000332167 CCTCATTGTGACCCTGACTTT pLKO_005 1652 CDS 100% 4.950 3.465 N Prmt3 n/a
5 TRCN0000097489 CCTGCTAGACTGAGAGTCATT pLKO.1 1967 3UTR 100% 4.950 3.465 N Prmt3 n/a
6 TRCN0000332168 CCTGCTAGACTGAGAGTCATT pLKO_005 1967 3UTR 100% 4.950 3.465 N Prmt3 n/a
7 TRCN0000097491 CGCACAGAAAGTTACAGAGAT pLKO.1 825 CDS 100% 4.950 3.465 N Prmt3 n/a
8 TRCN0000097490 GCACAGAAAGTTACAGAGATT pLKO.1 826 CDS 100% 4.950 3.465 N Prmt3 n/a
9 TRCN0000332234 GCACAGAAAGTTACAGAGATT pLKO_005 826 CDS 100% 4.950 3.465 N Prmt3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133740.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.