Transcript: Mouse NM_133762.3

Mus musculus non-SMC condensin II complex, subunit G2 (Ncapg2), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Ncapg2 (76044)
Length:
6604
CDS:
272..3688

Additional Resources:

NCBI RefSeq record:
NM_133762.3
NBCI Gene record:
Ncapg2 (76044)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133762.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437752 CAAGCTGAGCCACCCATTATT pLKO_005 1618 CDS 100% 15.000 21.000 N Ncapg2 n/a
2 TRCN0000216091 CACCAATACTTAACGTATTTA pLKO.1 6351 3UTR 100% 1.500 2.100 N Ncapg2 n/a
3 TRCN0000434503 GCCTGTGACTTACCCATTATT pLKO_005 4016 3UTR 100% 15.000 10.500 N Ncapg2 n/a
4 TRCN0000201510 CCAAGGCAGAACTGGAATCAT pLKO.1 2640 CDS 100% 5.625 3.938 N Ncapg2 n/a
5 TRCN0000191740 GCAGGCTTACTAGAAATCATT pLKO.1 2117 CDS 100% 5.625 3.938 N Ncapg2 n/a
6 TRCN0000191346 CAATGAGAACTTTGGGAGAAT pLKO.1 3654 CDS 100% 4.950 3.465 N Ncapg2 n/a
7 TRCN0000201746 GCCAGGAGGTTCTATCAGTAT pLKO.1 1919 CDS 100% 4.950 3.465 N Ncapg2 n/a
8 TRCN0000191969 GCTGCATTGTTGTTTGTTGAA pLKO.1 1316 CDS 100% 4.950 3.465 N Ncapg2 n/a
9 TRCN0000190678 GCCTGTATCTTCAGGAAGCAA pLKO.1 3152 CDS 100% 3.000 2.100 N Ncapg2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133762.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.