Transcript: Mouse NM_133774.5

Mus musculus StAR-related lipid transfer (START) domain containing 4 (Stard4), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Stard4 (170459)
Length:
5314
CDS:
192..866

Additional Resources:

NCBI RefSeq record:
NM_133774.5
NBCI Gene record:
Stard4 (170459)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133774.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105181 CCCGAGAGAGTTTGTTGATTT pLKO.1 575 CDS 100% 13.200 18.480 N Stard4 n/a
2 TRCN0000105183 GAGTCTTCTTACAGGCTATAT pLKO.1 737 CDS 100% 13.200 18.480 N Stard4 n/a
3 TRCN0000312122 GAGTCTTCTTACAGGCTATAT pLKO_005 737 CDS 100% 13.200 18.480 N Stard4 n/a
4 TRCN0000349820 GTCTATTCACATGGGTCAAAT pLKO_005 1122 3UTR 100% 13.200 18.480 N Stard4 n/a
5 TRCN0000105182 GCCTCTATTTCAACTAAACTT pLKO.1 261 CDS 100% 5.625 7.875 N Stard4 n/a
6 TRCN0000105184 CGGTTAATGACCTCCCTGGAT pLKO.1 480 CDS 100% 2.640 3.696 N Stard4 n/a
7 TRCN0000349866 TATGGATGACGTGGTCAATAA pLKO_005 413 CDS 100% 13.200 10.560 N Stard4 n/a
8 TRCN0000313060 TTGGACTGGGACCGGTTAATG pLKO_005 468 CDS 100% 13.200 10.560 N Stard4 n/a
9 TRCN0000105180 GCTATGTAAATAGGGCATTTA pLKO.1 1024 3UTR 100% 1.320 1.056 N Stard4 n/a
10 TRCN0000313100 GTCTGATGTTGCCTCTATTTC pLKO_005 251 CDS 100% 13.200 9.240 N Stard4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133774.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.