Transcript: Mouse NM_133775.2

Mus musculus interleukin 33 (Il33), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Il33 (77125)
Length:
2534
CDS:
60..860

Additional Resources:

NCBI RefSeq record:
NM_133775.2
NBCI Gene record:
Il33 (77125)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133775.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000174327 CCTGGTTCTAAACAAATGATT pLKO.1 1244 3UTR 100% 5.625 7.875 N Il33 n/a
2 TRCN0000320259 CCTGGTTCTAAACAAATGATT pLKO_005 1244 3UTR 100% 5.625 7.875 N Il33 n/a
3 TRCN0000193611 GAGCTGCAACAATATTATGTT pLKO.1 821 CDS 100% 5.625 3.938 N Il33 n/a
4 TRCN0000215665 GGATGTTATGTGATCAATGTT pLKO.1 471 CDS 100% 5.625 3.938 N Il33 n/a
5 TRCN0000173324 GCCAATAGAATGGGATCTCAT pLKO.1 1637 3UTR 100% 4.950 3.465 N Il33 n/a
6 TRCN0000320335 GCCAATAGAATGGGATCTCAT pLKO_005 1637 3UTR 100% 4.950 3.465 N Il33 n/a
7 TRCN0000176387 CCATAAGAAAGGAGACTAGTT pLKO.1 220 CDS 100% 0.000 0.000 N Il33 n/a
8 TRCN0000320257 CCATAAGAAAGGAGACTAGTT pLKO_005 220 CDS 100% 0.000 0.000 N Il33 n/a
9 TRCN0000173352 GCATCCAAGGAACTTCACTTT pLKO.1 385 CDS 100% 4.950 2.970 N Il33 n/a
10 TRCN0000320258 GCATCCAAGGAACTTCACTTT pLKO_005 385 CDS 100% 4.950 2.970 N Il33 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133775.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.