Transcript: Mouse NM_133821.3

Mus musculus PH domain and leucine rich repeat protein phosphatase 1 (Phlpp1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Phlpp1 (98432)
Length:
6123
CDS:
136..5199

Additional Resources:

NCBI RefSeq record:
NM_133821.3
NBCI Gene record:
Phlpp1 (98432)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133821.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238471 GTCTACCCAGTTCCGAATTAT pLKO_005 2668 CDS 100% 15.000 21.000 N Phlpp1 n/a
2 TRCN0000238473 GGTTGCATCACAGCGTATAAG pLKO_005 1902 CDS 100% 13.200 18.480 N Phlpp1 n/a
3 TRCN0000238469 TAATAGTAGTCTCCGGAAATT pLKO_005 2817 CDS 100% 13.200 18.480 N Phlpp1 n/a
4 TRCN0000081361 CGGAATGTACAATGTCCGAAA pLKO.1 1623 CDS 100% 4.050 5.670 N Phlpp1 n/a
5 TRCN0000081359 GCTCAATAACATTCGCTGCTT pLKO.1 3453 CDS 100% 2.640 3.696 N Phlpp1 n/a
6 TRCN0000238470 CATAAGGACACAGCCTAAATA pLKO_005 5799 3UTR 100% 15.000 10.500 N Phlpp1 n/a
7 TRCN0000081362 CGCAGCCCTGTCTGTAAATAA pLKO.1 3573 CDS 100% 15.000 10.500 N Phlpp1 n/a
8 TRCN0000238472 TTGAACGTTTGTGGCTATTTC pLKO_005 2602 CDS 100% 13.200 9.240 N Phlpp1 n/a
9 TRCN0000081360 GCAAAGGTTCACCAAATTGAA pLKO.1 2064 CDS 100% 5.625 3.938 N Phlpp1 n/a
10 TRCN0000081358 CCCTAACATATCAACTGTGTA pLKO.1 5424 3UTR 100% 4.950 3.465 N Phlpp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133821.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.