Transcript: Mouse NM_133871.2

Mus musculus interferon-induced protein 44 (Ifi44), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Ifi44 (99899)
Length:
2916
CDS:
183..1451

Additional Resources:

NCBI RefSeq record:
NM_133871.2
NBCI Gene record:
Ifi44 (99899)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133871.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000091560 CGCAATAATGTCATACCTATT pLKO.1 576 CDS 100% 10.800 15.120 N Ifi44 n/a
2 TRCN0000091559 GCACTCCAAGAGACTGGATTT pLKO.1 420 CDS 100% 10.800 15.120 N Ifi44 n/a
3 TRCN0000091562 GTTATTGGCATGTACCTGAAA pLKO.1 360 CDS 100% 4.950 6.930 N Ifi44 n/a
4 TRCN0000091561 CCTGACAGATACCAGTTCGAT pLKO.1 990 CDS 100% 3.000 4.200 N Ifi44 n/a
5 TRCN0000091558 CCTCATTTATTTCTGCTTCAT pLKO.1 2247 3UTR 100% 4.950 3.465 N Ifi44 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2143 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133871.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.