Transcript: Mouse NM_133908.1

Mus musculus RBPJ interacting and tubulin associated 1 (Rita1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Rita1 (100764)
Length:
1668
CDS:
495..1256

Additional Resources:

NCBI RefSeq record:
NM_133908.1
NBCI Gene record:
Rita1 (100764)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133908.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000201488 CTACTGCGATGAGTCACTGTT pLKO.1 785 CDS 100% 4.950 6.930 N Rita1 n/a
2 TRCN0000282634 ACGGTGAGGATGGGCCATATT pLKO_005 1371 3UTR 100% 13.200 9.240 N Rita1 n/a
3 TRCN0000263439 ACTGCGATGAGTCACTGTTTG pLKO_005 787 CDS 100% 10.800 7.560 N Rita1 n/a
4 TRCN0000345289 GCCTCCTTGGAAGTGAGATTC pLKO_005 1241 CDS 100% 10.800 7.560 N Rita1 n/a
5 TRCN0000263438 AGGCATGCTCAGGTCGTGTTT pLKO_005 1174 CDS 100% 4.950 3.465 N Rita1 n/a
6 TRCN0000345301 ATTCACTCACCCACCTAACTG pLKO_005 1045 CDS 100% 4.950 3.465 N Rita1 n/a
7 TRCN0000190498 GTCACTGTTTGGCACTAGCAA pLKO.1 797 CDS 100% 3.000 2.100 N Rita1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133908.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.