Transcript: Mouse NM_133955.4

Mus musculus ras homolog family member U (Rhou), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Rhou (69581)
Length:
3367
CDS:
18..803

Additional Resources:

NCBI RefSeq record:
NM_133955.4
NBCI Gene record:
Rhou (69581)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133955.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000077503 CGTGACCAGTTATATTGCTAT pLKO.1 1397 3UTR 100% 4.950 6.930 N Rhou n/a
2 TRCN0000287359 CGTGACCAGTTATATTGCTAT pLKO_005 1397 3UTR 100% 4.950 6.930 N Rhou n/a
3 TRCN0000077506 CGAGTACATCCCTACGGCCTT pLKO.1 254 CDS 100% 0.720 1.008 N Rhou n/a
4 TRCN0000294851 AGAAGTGGGTTCCAGAGATTC pLKO_005 448 CDS 100% 10.800 7.560 N Rhou n/a
5 TRCN0000077505 GACGTCAAAGTGCTCATAGAA pLKO.1 528 CDS 100% 5.625 3.938 N Rhou n/a
6 TRCN0000287358 GACGTCAAAGTGCTCATAGAA pLKO_005 528 CDS 100% 5.625 3.938 N Rhou n/a
7 TRCN0000048657 CTACACCAACACAGACATCTT pLKO.1 377 CDS 100% 4.950 3.465 N RHOU n/a
8 TRCN0000077507 CTGCTACACCAACACAGACAT pLKO.1 374 CDS 100% 4.950 3.465 N Rhou n/a
9 TRCN0000287361 CTGCTACACCAACACAGACAT pLKO_005 374 CDS 100% 4.950 3.465 N Rhou n/a
10 TRCN0000077504 GCTACAGCCAAAGAAGTCTAA pLKO.1 713 CDS 100% 4.950 3.465 N Rhou n/a
11 TRCN0000287360 GCTACAGCCAAAGAAGTCTAA pLKO_005 713 CDS 100% 4.950 3.465 N Rhou n/a
12 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1712 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133955.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.