Transcript: Mouse NM_134046.5

Mus musculus centromere protein O (Cenpo), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Cenpo (52504)
Length:
4343
CDS:
625..1521

Additional Resources:

NCBI RefSeq record:
NM_134046.5
NBCI Gene record:
Cenpo (52504)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_134046.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000329469 TTGCTGTCGTTCACCTATAAA pLKO_005 1267 CDS 100% 15.000 21.000 N Cenpo n/a
2 TRCN0000191285 CTCAAACGAACATATCGAATA pLKO.1 701 CDS 100% 10.800 15.120 N Cenpo n/a
3 TRCN0000201318 GCTCAAACGAACATATCGAAT pLKO.1 700 CDS 100% 4.950 6.930 N Cenpo n/a
4 TRCN0000329403 GCATGTGCTGGGCCACTATTT pLKO_005 1956 3UTR 100% 13.200 10.560 N Cenpo n/a
5 TRCN0000329402 TAGAGGCTCAAACGAACATAT pLKO_005 695 CDS 100% 13.200 10.560 N Cenpo n/a
6 TRCN0000329470 ACTGCGGCAACAACGAGATAA pLKO_005 783 CDS 100% 13.200 9.240 N Cenpo n/a
7 TRCN0000190919 CCTGTTTAGACTCTGGGAATA pLKO.1 1146 CDS 100% 10.800 7.560 N Cenpo n/a
8 TRCN0000329468 CCTGTTTAGACTCTGGGAATA pLKO_005 1146 CDS 100% 10.800 7.560 N Cenpo n/a
9 TRCN0000190217 CCACGAATGTCACTGTGACAA pLKO.1 1358 CDS 100% 4.950 3.465 N Cenpo n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_134046.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.