Transcript: Mouse NM_134097.3

Mus musculus topoisomerase I binding, arginine/serine-rich (Topors), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Topors (106021)
Length:
3842
CDS:
166..3267

Additional Resources:

NCBI RefSeq record:
NM_134097.3
NBCI Gene record:
Topors (106021)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_134097.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000272773 GTGGCCGCTACAGGGATATTT pLKO_005 995 CDS 100% 15.000 21.000 N TOPORS n/a
2 TRCN0000099110 CCATTTCTTAGACTGAAGTAA pLKO.1 3678 3UTR 100% 5.625 7.875 N Topors n/a
3 TRCN0000099114 GCTTGCCTTCACAGATTAGTT pLKO.1 1042 CDS 100% 5.625 7.875 N Topors n/a
4 TRCN0000099111 GCGGGTATTGAATGTAGCAAT pLKO.1 2920 CDS 100% 4.950 6.930 N Topors n/a
5 TRCN0000099113 CGGAACTTGTTGAACTGTCTT pLKO.1 1643 CDS 100% 4.950 3.960 N Topors n/a
6 TRCN0000099112 GCTGAGTTCTTCCGTAGAAAT pLKO.1 1018 CDS 100% 13.200 9.240 N Topors n/a
7 TRCN0000007519 CCTGATTCTAAGTGTCCTATA pLKO.1 463 CDS 100% 10.800 7.560 N TOPORS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_134097.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.