Transcript: Mouse NM_134126.3

Mus musculus intraflagellar transport 140 (Ift140), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Ift140 (106633)
Length:
5814
CDS:
851..5245

Additional Resources:

NCBI RefSeq record:
NM_134126.3
NBCI Gene record:
Ift140 (106633)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_134126.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265204 ATTGAGGCAGCCCGGTATTAT pLKO_005 4055 CDS 100% 15.000 12.000 N Ift140 n/a
2 TRCN0000265221 GAATACCAGATGGCCTATAAG pLKO_005 5024 CDS 100% 13.200 10.560 N Ift140 n/a
3 TRCN0000251558 ATGGAAGTGCCTCACTATTAC pLKO_005 3020 CDS 100% 13.200 9.240 N Ift140 n/a
4 TRCN0000251559 CCACTCCTGAAACACGAATAT pLKO_005 1274 CDS 100% 13.200 9.240 N Ift140 n/a
5 TRCN0000265321 GCATCCTGCAACCTCACTTAG pLKO_005 5260 3UTR 100% 10.800 7.560 N Ift140 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_134126.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.