Transcript: Mouse NM_134134.2

Mus musculus HMG box domain containing 3 (Hmgxb3), transcript variant 2, mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Hmgxb3 (106894)
Length:
5116
CDS:
476..4240

Additional Resources:

NCBI RefSeq record:
NM_134134.2
NBCI Gene record:
Hmgxb3 (106894)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_134134.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098866 GCAGACCTCTTGGTCGAATTA pLKO.1 2575 CDS 100% 13.200 18.480 N Hmgxb3 n/a
2 TRCN0000302916 GCAGACCTCTTGGTCGAATTA pLKO_005 2575 CDS 100% 13.200 18.480 N Hmgxb3 n/a
3 TRCN0000098865 CCTGCCTTGCTGGCTTATTTA pLKO.1 4623 3UTR 100% 15.000 10.500 N Hmgxb3 n/a
4 TRCN0000302918 CCTGCCTTGCTGGCTTATTTA pLKO_005 4623 3UTR 100% 15.000 10.500 N Hmgxb3 n/a
5 TRCN0000098867 CCACCTGTCTATGTGGTAGAT pLKO.1 3656 CDS 100% 4.950 3.465 N Hmgxb3 n/a
6 TRCN0000098868 GCACTGGTGAAGTAAAGCTAT pLKO.1 2091 CDS 100% 4.950 3.465 N Hmgxb3 n/a
7 TRCN0000302835 GCACTGGTGAAGTAAAGCTAT pLKO_005 2091 CDS 100% 4.950 3.465 N Hmgxb3 n/a
8 TRCN0000098869 CCAGCATTATTCTGTGGATGT pLKO.1 3811 CDS 100% 4.050 2.835 N Hmgxb3 n/a
9 TRCN0000302836 CCAGCATTATTCTGTGGATGT pLKO_005 3811 CDS 100% 4.050 2.835 N Hmgxb3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_134134.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.