Transcript: Mouse NM_134179.1

Mus musculus vomeronasal 1 receptor 23 (Vmn1r23), mRNA.

Source:
NCBI, updated 2012-08-25
Taxon:
Mus musculus (mouse)
Gene:
Vmn1r23 (171197)
Length:
909
CDS:
1..909

Additional Resources:

NCBI RefSeq record:
NM_134179.1
NBCI Gene record:
Vmn1r23 (171197)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_134179.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000173420 GTTACTCACTGCAGGAGATAA pLKO.1 156 CDS 100% 13.200 9.240 N Vmn1r23 n/a
2 TRCN0000193366 CCAATATGTTTCTGCTGATTT pLKO.1 53 CDS 100% 13.200 7.920 N Vmn1r23 n/a
3 TRCN0000193582 GAGTCACTGAACATTAAGAAT pLKO.1 196 CDS 100% 5.625 3.375 N Vmn1r23 n/a
4 TRCN0000194228 GCCAATATGTTTCTGCTGATT pLKO.1 52 CDS 100% 4.950 2.970 N Vmn1r23 n/a
5 TRCN0000250950 ACTTGGAGTCCTAGCCAATAT pLKO_005 39 CDS 100% 13.200 6.600 Y Vmn1r9 n/a
6 TRCN0000125880 GCTGACCACAAGTATATACAT pLKO.1 573 CDS 100% 5.625 2.813 Y Vmn1r22 n/a
7 TRCN0000125883 CCAACCAGATGAGAATCACTA pLKO.1 461 CDS 100% 4.950 2.475 Y Vmn1r22 n/a
8 TRCN0000173442 CCAACCAGATGAGAATCACTA pLKO.1 461 CDS 100% 4.950 2.475 Y Vmn1r23 n/a
9 TRCN0000193886 CCACAAGTATATACATGGTGA pLKO.1 578 CDS 100% 2.640 1.320 Y Vmn1r23 n/a
10 TRCN0000175437 CAAGCATCTTCATAGCATCAA pLKO.1 627 CDS 100% 4.950 2.475 Y Vmn1r6 n/a
11 TRCN0000080545 GCTGTCACTATCAGTCCCAAT pLKO.1 304 CDS 100% 4.050 2.025 Y Vmn1r10 n/a
12 TRCN0000126020 GCTGTCACTATCAGTCCCAAA pLKO.1 304 CDS 100% 4.050 2.025 Y Vmn1r17 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_134179.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.