Transcript: Mouse NM_134184.2

Mus musculus vomeronasal 1 receptor 16 (Vmn1r16), mRNA.

Source:
NCBI, updated 2012-08-25
Taxon:
Mus musculus (mouse)
Gene:
Vmn1r16 (171202)
Length:
912
CDS:
1..912

Additional Resources:

NCBI RefSeq record:
NM_134184.2
NBCI Gene record:
Vmn1r16 (171202)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_134184.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000125500 CCAAGCTGGATTTGGACTCTT pLKO.1 30 CDS 100% 4.950 2.970 N Vmn1r16 n/a
2 TRCN0000125503 CCATCTTACTGCTGGTGGTTT pLKO.1 686 CDS 100% 4.950 2.970 N Vmn1r16 n/a
3 TRCN0000125501 CCAGTACATCACTGTTGGCAA pLKO.1 320 CDS 100% 2.640 1.584 N Vmn1r16 n/a
4 TRCN0000125502 CTGACCTTTGTTCACATAATA pLKO.1 133 CDS 100% 15.000 7.500 Y Vmn1r16 n/a
5 TRCN0000415824 GACCTTTGTTCACATAATAAT pLKO_005 135 CDS 100% 15.000 7.500 Y Vmn1r10 n/a
6 TRCN0000250949 TGACCTTTGTTCACATAATAA pLKO_005 134 CDS 100% 15.000 7.500 Y Vmn1r9 n/a
7 TRCN0000453482 ACATTGAGAATGACTTCAAAT pLKO_005 206 CDS 100% 13.200 6.600 Y Vmn1r16 n/a
8 TRCN0000217168 CCAGATGAAGGTCACTAAATC pLKO.1 465 CDS 100% 13.200 6.600 Y Vmn1r28 n/a
9 TRCN0000420259 GTATGCCTATCCCACAATTAC pLKO_005 807 CDS 100% 13.200 6.600 Y Vmn1r10 n/a
10 TRCN0000444481 GTAGTAGGTTGATCTTCTATG pLKO_005 413 CDS 100% 10.800 5.400 Y Vmn1r16 n/a
11 TRCN0000203328 CAACTGACCTTTGTTCACATA pLKO.1 130 CDS 100% 4.950 2.475 Y Vmn1r9 n/a
12 TRCN0000198622 CACTAAATCCTGCTCACTCTT pLKO.1 477 CDS 100% 4.950 2.475 Y Vmn1r19 n/a
13 TRCN0000125499 CCACCAGATGAAGGTCACTAA pLKO.1 462 CDS 100% 4.950 2.475 Y Vmn1r16 n/a
14 TRCN0000178275 GATCTTCTATGTTGCTGGTTT pLKO.1 423 CDS 100% 4.950 2.475 Y Vmn1r19 n/a
15 TRCN0000181136 CCTATCCCACAATTACTCCTT pLKO.1 812 CDS 100% 2.640 1.320 Y Vmn1r32 n/a
16 TRCN0000175437 CAAGCATCTTCATAGCATCAA pLKO.1 627 CDS 100% 4.950 2.475 Y Vmn1r6 n/a
17 TRCN0000175826 GTGGACTTCATCATCTCATTT pLKO.1 727 CDS 100% 13.200 6.600 Y Vmn1r8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_134184.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.