Transcript: Mouse NM_134222.1

Mus musculus vomeronasal 1 receptor 218 (Vmn1r218), mRNA.

Source:
NCBI, updated 2012-08-25
Taxon:
Mus musculus (mouse)
Gene:
Vmn1r218 (171256)
Length:
897
CDS:
1..897

Additional Resources:

NCBI RefSeq record:
NM_134222.1
NBCI Gene record:
Vmn1r218 (171256)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_134222.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000126147 TCATGAGATATGTGTACACTT pLKO.1 74 CDS 100% 4.950 6.930 N Vmn1r218 n/a
2 TRCN0000126144 CATCCAGACATATCATCAAAT pLKO.1 509 CDS 100% 13.200 9.240 N Vmn1r218 n/a
3 TRCN0000437135 GCACAGGAGTCACAGATATAG pLKO_005 173 CDS 100% 13.200 9.240 N Vmn1r218 n/a
4 TRCN0000413598 TGACACATGATTCTACGTTAC pLKO_005 776 CDS 100% 6.000 4.200 N Vmn1r218 n/a
5 TRCN0000126146 GCCTTCTTCCTGTTCTTCTAT pLKO.1 715 CDS 100% 5.625 3.938 N Vmn1r218 n/a
6 TRCN0000126145 TGGAGTTGTAGGAAATATCTT pLKO.1 48 CDS 100% 5.625 3.938 N Vmn1r218 n/a
7 TRCN0000426571 AGCTCAAGCCACAGACGTCAT pLKO_005 350 CDS 100% 4.050 2.835 N Vmn1r218 n/a
8 TRCN0000433770 GGTCTTTCCATCTGCACTACC pLKO_005 271 CDS 100% 4.050 2.835 N Vmn1r218 n/a
9 TRCN0000188107 CCATCTGTATAAGCACCACAA pLKO.1 609 CDS 100% 4.050 2.025 Y Vmn1r201 n/a
10 TRCN0000126148 CCTACATCAAAGCAGGCAGTA pLKO.1 437 CDS 100% 4.050 2.025 Y Vmn1r218 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_134222.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.