Transcript: Mouse NM_134224.1

Mus musculus vomeronasal 1 receptor 202 (Vmn1r202), mRNA.

Source:
NCBI, updated 2015-08-05
Taxon:
Mus musculus (mouse)
Gene:
Vmn1r202 (171258)
Length:
909
CDS:
1..909

Additional Resources:

NCBI RefSeq record:
NM_134224.1
NBCI Gene record:
Vmn1r202 (171258)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_134224.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000125759 GTCAGAACCATAGCCATGATT pLKO.1 193 CDS 100% 5.625 4.500 N Vmn1r202 n/a
2 TRCN0000125761 ACATGTGCATACTTTCATCAT pLKO.1 93 CDS 100% 4.950 3.465 N Vmn1r202 n/a
3 TRCN0000432551 CTTTGATGTCCATATTGCTAA pLKO_005 870 CDS 100% 4.950 3.465 N Vmn1r202 n/a
4 TRCN0000429975 TCTCATGGCTGTTCGCGATGT pLKO_005 555 CDS 100% 4.050 2.835 N Vmn1r202 n/a
5 TRCN0000125763 GCCATCCAGGAACACAGTTAA pLKO.1 519 CDS 100% 13.200 7.920 N Vmn1r202 n/a
6 TRCN0000414810 AGGGAACATCATCTTATTTGT pLKO_005 69 CDS 100% 5.625 3.375 N Vmn1r202 n/a
7 TRCN0000125762 GCAGACAATTCTAGGCCAGAA pLKO.1 673 CDS 100% 4.050 2.430 N Vmn1r202 n/a
8 TRCN0000125760 CCATCTGTATAAGCATCACAA pLKO.1 621 CDS 100% 4.950 2.475 Y Vmn1r202 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_134224.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.