Transcript: Human NM_138318.2

Homo sapiens potassium two pore domain channel subfamily K member 10 (KCNK10), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-06-07
Taxon:
Homo sapiens (human)
Gene:
KCNK10 (54207)
Length:
7198
CDS:
123..1754

Additional Resources:

NCBI RefSeq record:
NM_138318.2
NBCI Gene record:
KCNK10 (54207)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_138318.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433339 CAATTATCGGGAGTGGTATAA pLKO_005 1007 CDS 100% 13.200 18.480 N KCNK10 n/a
2 TRCN0000416674 ATGCGGGAGTCAGTCCAATAG pLKO_005 544 CDS 100% 10.800 15.120 N KCNK10 n/a
3 TRCN0000044578 CCGGAGAACAACTCATTACTT pLKO.1 1719 CDS 100% 5.625 7.875 N KCNK10 n/a
4 TRCN0000044580 GCCTTGGAGTCCATTTACTTT pLKO.1 924 CDS 100% 5.625 3.938 N KCNK10 n/a
5 TRCN0000044581 GCTGGAATTGGAGACCAACTT pLKO.1 735 CDS 100% 4.950 3.465 N KCNK10 n/a
6 TRCN0000044582 GTCCTCAGTATGATCGGAGAT pLKO.1 1077 CDS 100% 4.050 2.835 N KCNK10 n/a
7 TRCN0000044579 CCAGAAGAATACCATCGCCTT pLKO.1 437 CDS 100% 2.160 1.296 N KCNK10 n/a
8 TRCN0000125693 CCCACTCACTGGACATGCTAT pLKO.1 1294 CDS 100% 4.950 2.970 N Kcnk10 n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 5849 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_138318.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.