Transcript: Human NM_138322.4

Homo sapiens proprotein convertase subtilisin/kexin type 6 (PCSK6), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
PCSK6 (5046)
Length:
2049
CDS:
38..1501

Additional Resources:

NCBI RefSeq record:
NM_138322.4
NBCI Gene record:
PCSK6 (5046)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_138322.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425553 GACGTGAACGGCAATGATTAT pLKO_005 713 CDS 100% 13.200 18.480 N PCSK6 n/a
2 TRCN0000075250 CCTGGAAGATTACTACCATTT pLKO.1 343 CDS 100% 10.800 7.560 N PCSK6 n/a
3 TRCN0000431667 GCTTTCGAGTATGGCATTAAA pLKO_005 1010 CDS 100% 15.000 9.000 N PCSK6 n/a
4 TRCN0000075251 CCACGATATGATGCCAGCAAT pLKO.1 743 CDS 100% 4.950 2.970 N PCSK6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_138322.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.