Transcript: Human NM_138442.3

Homo sapiens coiled-coil domain containing 124 (CCDC124), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-02-21
Taxon:
Homo sapiens (human)
Gene:
CCDC124 (115098)
Length:
1066
CDS:
108..779

Additional Resources:

NCBI RefSeq record:
NM_138442.3
NBCI Gene record:
CCDC124 (115098)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_138442.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000242989 TCACGACTCTGCACGCCCTTA pLKO_005 822 3UTR 100% 1.350 1.890 N CCDC124 n/a
2 TRCN0000242988 ACTGGAAGGACGACGACAAAC pLKO_005 220 CDS 100% 10.800 7.560 N CCDC124 n/a
3 TRCN0000242986 TCGACCAGCTGGAACGTAAGA pLKO_005 289 CDS 100% 4.950 3.465 N CCDC124 n/a
4 TRCN0000242987 CGAGAAAGCCAAGAGCCATCT pLKO_005 458 CDS 100% 4.050 2.835 N CCDC124 n/a
5 TRCN0000242985 GAAACAGCTGCTCAAGAAGGA pLKO_005 695 CDS 100% 2.640 1.584 N CCDC124 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_138442.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09412 pDONR223 100% 99.7% 99.5% None 54T>G;653C>A n/a
2 ccsbBroad304_09412 pLX_304 0% 99.7% 99.5% V5 54T>G;653C>A n/a
Download CSV