Transcript: Mouse NM_138590.4

Mus musculus zinc finger, CCHC domain containing 7 (Zcchc7), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Zcchc7 (319885)
Length:
2545
CDS:
159..1784

Additional Resources:

NCBI RefSeq record:
NM_138590.4
NBCI Gene record:
Zcchc7 (319885)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_138590.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000339292 GTGCACAGAAAGGCCATTATG pLKO_005 1201 CDS 100% 13.200 18.480 N Zcchc7 n/a
2 TRCN0000339223 GTGACCGATGTGATATGATAG pLKO_005 1060 CDS 100% 10.800 15.120 N Zcchc7 n/a
3 TRCN0000191260 CCGATACTATTCAGTCAACAA pLKO.1 839 CDS 100% 4.950 6.930 N Zcchc7 n/a
4 TRCN0000339220 CCGATACTATTCAGTCAACAA pLKO_005 839 CDS 100% 4.950 6.930 N Zcchc7 n/a
5 TRCN0000178999 CGAATGTTTAACCAGACGTTT pLKO.1 1242 CDS 100% 4.950 6.930 N Zcchc7 n/a
6 TRCN0000183002 CATATATTGCTATGATGGCAA pLKO.1 1277 CDS 100% 2.640 3.696 N Zcchc7 n/a
7 TRCN0000181010 GCAAAGGGATCGGAGAATAAA pLKO.1 1310 CDS 100% 15.000 12.000 N Zcchc7 n/a
8 TRCN0000215988 CTCATTGGAAGAAAGTTTATT pLKO.1 2046 3UTR 100% 15.000 10.500 N Zcchc7 n/a
9 TRCN0000215929 CTCCAATGTTTGAGGACTTAA pLKO.1 2022 3UTR 100% 13.200 9.240 N Zcchc7 n/a
10 TRCN0000339294 CTCTACAGCCAAGTCCATTAT pLKO_005 258 CDS 100% 13.200 9.240 N Zcchc7 n/a
11 TRCN0000215367 CTGTACAGAACAGCATGTAAA pLKO.1 2174 3UTR 100% 13.200 9.240 N Zcchc7 n/a
12 TRCN0000339222 TACAAGCTCATCAGATGATTT pLKO_005 1998 3UTR 100% 13.200 9.240 N Zcchc7 n/a
13 TRCN0000179401 GCCATTATGGACATGAATGTA pLKO.1 1213 CDS 100% 5.625 3.938 N Zcchc7 n/a
14 TRCN0000191464 CGTGATGATTCATCTAGTGAA pLKO.1 207 CDS 100% 4.950 3.465 N Zcchc7 n/a
15 TRCN0000183317 GCCATGATGATTTGTTTCTTA pLKO.1 1723 CDS 100% 5.625 3.375 N Zcchc7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_138590.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.