Transcript: Mouse NM_138646.3

Mus musculus HPS4, biogenesis of lysosomal organelles complex 3 subunit 2 (Hps4), mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Hps4 (192232)
Length:
2852
CDS:
537..2552

Additional Resources:

NCBI RefSeq record:
NM_138646.3
NBCI Gene record:
Hps4 (192232)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_138646.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257916 GGAACTGGACTCGTCTGAAAT pLKO_005 1595 CDS 100% 13.200 18.480 N Hps4 n/a
2 TRCN0000217889 GTATGACGGTTCCAAGGTAAA pLKO.1 596 CDS 100% 10.800 15.120 N Hps4 n/a
3 TRCN0000249662 GTATGACGGTTCCAAGGTAAA pLKO_005 596 CDS 100% 10.800 15.120 N Hps4 n/a
4 TRCN0000189449 CGAATCGCACAGGATCTTCAA pLKO.1 989 CDS 100% 4.950 6.930 N Hps4 n/a
5 TRCN0000200539 CACATACAACTTCCTTCATTA pLKO.1 2225 CDS 100% 13.200 9.240 N Hps4 n/a
6 TRCN0000249661 ACCTCATGCACTCCGACTTTG pLKO_005 2326 CDS 100% 10.800 7.560 N Hps4 n/a
7 TRCN0000257940 ATACCCTCCCTGGGATCAAAG pLKO_005 1361 CDS 100% 10.800 7.560 N Hps4 n/a
8 TRCN0000249660 TGGGTGCAGCTTGCATATCAC pLKO_005 2555 3UTR 100% 4.950 3.465 N Hps4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_138646.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.