Transcript: Mouse NM_138942.3

Mus musculus dopamine beta hydroxylase (Dbh), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Dbh (13166)
Length:
2282
CDS:
10..1878

Additional Resources:

NCBI RefSeq record:
NM_138942.3
NBCI Gene record:
Dbh (13166)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_138942.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000099035 CGACACCACATCATCATGTAT pLKO.1 748 CDS 100% 5.625 4.500 N Dbh n/a
2 TRCN0000099036 CCATCTAGTGTATGGGATCTT pLKO.1 519 CDS 100% 4.950 3.960 N Dbh n/a
3 TRCN0000436514 CGGAGAAGCCCTGGACATTAT pLKO_005 2067 3UTR 100% 13.200 9.240 N Dbh n/a
4 TRCN0000438411 ACTCCGGAATCCACATCTTTG pLKO_005 1223 CDS 100% 10.800 7.560 N Dbh n/a
5 TRCN0000418184 GAACTCTTTCAATCGGGATAT pLKO_005 1653 CDS 100% 10.800 7.560 N Dbh n/a
6 TRCN0000099038 CATCACTTCATGCACATACAA pLKO.1 1407 CDS 100% 5.625 3.938 N Dbh n/a
7 TRCN0000099039 GAGGATGTACAAACCATGGAT pLKO.1 646 CDS 100% 3.000 2.100 N Dbh n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_138942.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.