Transcript: Mouse NM_138955.3

Mus musculus ATP-binding cassette, sub-family G (WHITE), member 4 (Abcg4), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Abcg4 (192663)
Length:
3626
CDS:
244..2184

Additional Resources:

NCBI RefSeq record:
NM_138955.3
NBCI Gene record:
Abcg4 (192663)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_138955.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105203 CCGCAAGATGTCCTGCTACAT pLKO.1 660 CDS 100% 4.950 6.930 N Abcg4 n/a
2 TRCN0000105201 GCTTAGATGAACAGTGCCCAT pLKO.1 2018 CDS 100% 2.160 1.728 N Abcg4 n/a
3 TRCN0000105200 CCCAAGTTGATGCAGTTGGTA pLKO.1 2389 3UTR 100% 3.000 2.100 N Abcg4 n/a
4 TRCN0000105204 CCTGACCATCTATGGTATGGA pLKO.1 1980 CDS 100% 3.000 2.100 N Abcg4 n/a
5 TRCN0000105202 CCGCCTTAGTTGCCCAGTCTT pLKO.1 1781 CDS 100% 1.650 1.155 N Abcg4 n/a
6 TRCN0000059604 GCCAAGCTCTTTGAGATGTTT pLKO.1 1027 CDS 100% 5.625 3.375 N ABCG4 n/a
7 TRCN0000059603 CCGCCTGTCATGTTCTTTGAT pLKO.1 898 CDS 100% 5.625 2.813 Y ABCG4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_138955.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.