Transcript: Human NM_138971.3

Homo sapiens beta-secretase 1 (BACE1), transcript variant c, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
BACE1 (23621)
Length:
5732
CDS:
462..1835

Additional Resources:

NCBI RefSeq record:
NM_138971.3
NBCI Gene record:
BACE1 (23621)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_138971.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000272931 CTCTTGGTCACCTCAAATTTA pLKO_005 2068 3UTR 100% 15.000 10.500 N BACE1 n/a
2 TRCN0000000279 CACTGTTATGGGAGCTGTTAT pLKO.1 1502 CDS 100% 13.200 9.240 N BACE1 n/a
3 TRCN0000272866 TCGGAGGGAGCATGATCATTG pLKO_005 1021 CDS 100% 10.800 7.560 N BACE1 n/a
4 TRCN0000000277 GAGGGCTTCTACGTTGTCTTT pLKO.1 1527 CDS 100% 4.950 3.465 N BACE1 n/a
5 TRCN0000272933 GAGGGCTTCTACGTTGTCTTT pLKO_005 1527 CDS 100% 4.950 3.465 N BACE1 n/a
6 TRCN0000000280 AGTTTGCCATCTCACAGTCAT pLKO.1 1474 CDS 100% 4.950 2.970 N BACE1 n/a
7 TRCN0000272868 AGTTTGCCATCTCACAGTCAT pLKO_005 1474 CDS 100% 4.950 2.970 N BACE1 n/a
8 TRCN0000000278 GCACTGTTATGGGAGCTGTTA pLKO.1 1501 CDS 100% 4.950 2.970 N BACE1 n/a
9 TRCN0000272929 GCACTGTTATGGGAGCTGTTA pLKO_005 1501 CDS 100% 4.950 2.970 N BACE1 n/a
10 TRCN0000000276 CCAAGTTCATTACCTCCCTAT pLKO.1 3338 3UTR 100% 4.050 2.430 N BACE1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_138971.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.