Transcript: Human NM_138991.3

Homo sapiens beta-secretase 2 (BACE2), transcript variant c, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
BACE2 (25825)
Length:
8417
CDS:
105..1511

Additional Resources:

NCBI RefSeq record:
NM_138991.3
NBCI Gene record:
BACE2 (25825)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_138991.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426167 GTGGTACTACCAGATAGAAAT pLKO_005 917 CDS 100% 13.200 9.240 N BACE2 n/a
2 TRCN0000051318 CCGGCCTGAATTATGAATGTT pLKO.1 1114 CDS 100% 5.625 3.938 N BACE2 n/a
3 TRCN0000051322 CTGGGATTAAATGGAATGGAA pLKO.1 670 CDS 100% 3.000 2.100 N BACE2 n/a
4 TRCN0000051320 GCACTCCTACATAGACACGTA pLKO.1 470 CDS 100% 2.640 1.848 N BACE2 n/a
5 TRCN0000030503 CCAAGTTTGTATAAAGGAGAT pLKO.1 870 CDS 100% 4.050 2.835 N Bace2 n/a
6 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 5221 3UTR 100% 13.200 6.600 Y LIAS n/a
7 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 5388 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_138991.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.