Transcript: Human NM_139025.4

Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif 13 (ADAMTS13), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-21
Taxon:
Homo sapiens (human)
Gene:
ADAMTS13 (11093)
Length:
4966
CDS:
445..4728

Additional Resources:

NCBI RefSeq record:
NM_139025.4
NBCI Gene record:
ADAMTS13 (11093)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_139025.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000053795 GTCCTCTATATCACTAGGTTT pLKO.1 967 CDS 100% 4.950 6.930 N ADAMTS13 n/a
2 TRCN0000433115 ACCTGACCAGTGTCTACATTG pLKO_005 2180 CDS 100% 10.800 7.560 N ADAMTS13 n/a
3 TRCN0000437972 GAAGGAACCTGAGGGTCATTG pLKO_005 4717 CDS 100% 10.800 7.560 N ADAMTS13 n/a
4 TRCN0000053796 CCTGAAACCTTCTACAGAGAA pLKO.1 4318 CDS 100% 4.950 3.465 N ADAMTS13 n/a
5 TRCN0000053794 GCCAACAGGAACCATTGACAT pLKO.1 4038 CDS 100% 4.950 3.465 N ADAMTS13 n/a
6 TRCN0000438218 GTACTGGACCCTCCAATCATG pLKO_005 4656 CDS 100% 4.950 3.465 N ADAMTS13 n/a
7 TRCN0000053797 TGCAGGACATTTGGCTGTGAT pLKO.1 2023 CDS 100% 4.950 3.465 N ADAMTS13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_139025.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.