Transcript: Human NM_139052.3

Homo sapiens TATA-box binding protein associated factor 5 (TAF5), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
TAF5 (6877)
Length:
3094
CDS:
15..2252

Additional Resources:

NCBI RefSeq record:
NM_139052.3
NBCI Gene record:
TAF5 (6877)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_139052.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000342893 AGGATGACCTACGAGTATTAT pLKO_005 841 CDS 100% 15.000 21.000 N TAF5 n/a
2 TRCN0000342828 TCTAGCTGCAGGAGCTTATAG pLKO_005 2222 CDS 100% 13.200 18.480 N TAF5 n/a
3 TRCN0000342826 ACAATAAACCATCGGTATTAA pLKO_005 2246 CDS 100% 15.000 10.500 N TAF5 n/a
4 TRCN0000342825 AGCATCAGATCTTAGTCTTAT pLKO_005 1541 CDS 100% 13.200 9.240 N TAF5 n/a
5 TRCN0000414571 AGCATCAGATCTTAGTCTTAT pLKO_005 1541 CDS 100% 13.200 9.240 N Taf5 n/a
6 TRCN0000016186 CCGCGTAGTAAGCAACAGATA pLKO.1 1050 CDS 100% 4.950 3.465 N TAF5 n/a
7 TRCN0000016184 CCTGAGTTGAAAGATTCAGAT pLKO.1 1302 CDS 100% 4.950 3.465 N TAF5 n/a
8 TRCN0000016183 GCATGTATGTTTCTGCTGTAA pLKO.1 2644 3UTR 100% 4.950 3.465 N TAF5 n/a
9 TRCN0000016185 GCCACACTGATACAGTCTGTT pLKO.1 1975 CDS 100% 4.950 3.465 N TAF5 n/a
10 TRCN0000016187 GCCATCTTGCTGATGTGAATT pLKO.1 1723 CDS 100% 0.000 0.000 N TAF5 n/a
11 TRCN0000342827 GCAAATACCTCAGTGATTAAT pLKO_005 2309 3UTR 100% 15.000 9.000 N TAF5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_139052.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.