Transcript: Mouse NM_139063.1

Mus musculus biogenesis of lysosomal organelles complex-1, subunit 5, muted (Bloc1s5), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Bloc1s5 (17828)
Length:
1791
CDS:
69..626

Additional Resources:

NCBI RefSeq record:
NM_139063.1
NBCI Gene record:
Bloc1s5 (17828)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_139063.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000338116 TCGAGAATTGCGCGTTCTTAA pLKO_005 272 CDS 100% 13.200 18.480 N Bloc1s5 n/a
2 TRCN0000178825 CCAAGGTGAAATCCGTTACTT pLKO.1 221 CDS 100% 5.625 7.875 N Bloc1s5 n/a
3 TRCN0000350893 AGGTGATTAATGACTACTTGA pLKO_005 445 CDS 100% 4.950 6.930 N Bloc1s5 n/a
4 TRCN0000183759 CACCTCATTATCAAGGATCTT pLKO.1 159 CDS 100% 4.950 6.930 N Bloc1s5 n/a
5 TRCN0000179600 GCACCTCATTATCAAGGATCT pLKO.1 158 CDS 100% 4.050 5.670 N Bloc1s5 n/a
6 TRCN0000338047 ACCAGTTACCCAAGGTGAAAT pLKO_005 212 CDS 100% 13.200 9.240 N Bloc1s5 n/a
7 TRCN0000338114 GGATCTTGGAGAGATTCATTC pLKO_005 173 CDS 100% 10.800 7.560 N Bloc1s5 n/a
8 TRCN0000179061 CCCACACTGATGATGATGTAT pLKO.1 1357 3UTR 100% 5.625 3.938 N Bloc1s5 n/a
9 TRCN0000338044 CCCACACTGATGATGATGTAT pLKO_005 1357 3UTR 100% 5.625 3.938 N Bloc1s5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_139063.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.