Transcript: Human NM_139137.4

Homo sapiens potassium voltage-gated channel subfamily C member 2 (KCNC2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
KCNC2 (3747)
Length:
5596
CDS:
653..2569

Additional Resources:

NCBI RefSeq record:
NM_139137.4
NBCI Gene record:
KCNC2 (3747)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_139137.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430368 ACTCTTCGAGCTAGTACTAAT pLKO_005 1772 CDS 100% 13.200 18.480 N KCNC2 n/a
2 TRCN0000044845 CCTGCCTTGACGTATGTAGAA pLKO.1 1490 CDS 100% 4.950 6.930 N KCNC2 n/a
3 TRCN0000044844 CGCTCTAGTACCAGAGACAAA pLKO.1 2336 CDS 100% 4.950 3.960 N KCNC2 n/a
4 TRCN0000044846 CTGGGCAAAGACAATCGACTT pLKO.1 2228 CDS 100% 4.050 3.240 N KCNC2 n/a
5 TRCN0000419842 GTTGTGCTGTGAATTACTTAA pLKO_005 4856 3UTR 100% 13.200 9.240 N KCNC2 n/a
6 TRCN0000044843 CCTGGTTTCAATTACAACTTT pLKO.1 1369 CDS 100% 5.625 3.938 N KCNC2 n/a
7 TRCN0000044847 GCTGTCATCCAAAGCTGCTAA pLKO.1 1654 CDS 100% 4.950 3.465 N KCNC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_139137.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.