Transcript: Mouse NM_139200.4

Mus musculus cytohesin 1 interacting protein (Cytip), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Cytip (227929)
Length:
5735
CDS:
68..1147

Additional Resources:

NCBI RefSeq record:
NM_139200.4
NBCI Gene record:
Cytip (227929)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_139200.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000175796 GAGCAATTACTCAAGCGTGTT pLKO.1 1021 CDS 100% 4.050 5.670 N Cytip n/a
2 TRCN0000173796 CGAGTCGTCCTTGTTTGGAAA pLKO.1 724 CDS 100% 4.950 3.960 N Cytip n/a
3 TRCN0000175697 GATCAAGCTCTTTGGGTGATT pLKO.1 255 CDS 100% 4.950 3.960 N Cytip n/a
4 TRCN0000173942 GATGGAAGACAACCGAAGGAT pLKO.1 172 CDS 100% 3.000 2.400 N Cytip n/a
5 TRCN0000175489 CCTTGTTAGCTGTGCTTGTAT pLKO.1 2022 3UTR 100% 5.625 3.938 N Cytip n/a
6 TRCN0000174811 GCAGTGACCTTTAAGTTCTTA pLKO.1 1271 3UTR 100% 5.625 3.938 N Cytip n/a
7 TRCN0000175230 CCTCATTAAACATTCCACATA pLKO.1 1979 3UTR 100% 4.950 3.465 N Cytip n/a
8 TRCN0000175896 GTGTGCACTATGATCTGCAAA pLKO.1 386 CDS 100% 4.950 2.970 N Cytip n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_139200.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.