Transcript: Mouse NM_139218.1

Mus musculus developmental pluripotency-associated 3 (Dppa3), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Dppa3 (73708)
Length:
818
CDS:
100..552

Additional Resources:

NCBI RefSeq record:
NM_139218.1
NBCI Gene record:
Dppa3 (73708)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_139218.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000181635 GCTCGAAGGAAATGAGTTTGA pLKO.1 441 CDS 100% 4.950 6.930 N Dppa3 n/a
2 TRCN0000178589 CAGCAGATGTGAAAGCTATTT pLKO.1 595 3UTR 100% 13.200 9.240 N Dppa3 n/a
3 TRCN0000176725 CTTTCTGCCATTATCAAAGAT pLKO.1 494 CDS 100% 5.625 3.938 N Dppa3 n/a
4 TRCN0000178331 GAAACTCCTCAGAAGAAAGAT pLKO.1 142 CDS 100% 5.625 3.938 N Dppa3 n/a
5 TRCN0000182794 CCAATGAAGGACCCTGAAACT pLKO.1 127 CDS 100% 4.950 3.465 N Dppa3 n/a
6 TRCN0000177980 GCAAAGATGAGAAGACTTGTT pLKO.1 397 CDS 100% 4.950 3.465 N Dppa3 n/a
7 TRCN0000181731 GATGAGAAGACTTGTTCGGAT pLKO.1 402 CDS 100% 2.640 1.848 N Dppa3 n/a
8 TRCN0000198444 GCTGGGAAATCTTAACTTGTT pLKO.1 643 3UTR 100% 4.950 2.970 N Dppa3 n/a
9 TRCN0000182659 GATCCCTCTGAGAATGCGAAA pLKO.1 517 CDS 100% 4.050 2.430 N Dppa3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_139218.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.