Transcript: Mouse NM_139269.2

Mus musculus phospholipase A2, group XVI (Pla2g16), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Pla2g16 (225845)
Length:
3523
CDS:
156..644

Additional Resources:

NCBI RefSeq record:
NM_139269.2
NBCI Gene record:
Pla2g16 (225845)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_139269.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000353533 GGACAAGTACCAGGTCAATAA pLKO_005 368 CDS 100% 13.200 18.480 N Pla2g16 n/a
2 TRCN0000077662 AGCGAGAACTGTGAGCACTTT pLKO.1 483 CDS 100% 4.950 6.930 N Pla2g16 n/a
3 TRCN0000328771 CGCTGGAGTTTATGGATATTC pLKO_005 1055 3UTR 100% 13.200 10.560 N Pla2g16 n/a
4 TRCN0000328827 ACAGACACTGGGCCATCTATG pLKO_005 217 CDS 100% 10.800 7.560 N Pla2g16 n/a
5 TRCN0000328770 GGAGTCATGCTCTCCAGAAAC pLKO_005 606 CDS 100% 10.800 7.560 N Pla2g16 n/a
6 TRCN0000328772 TTGTGAATGAACTACGCTATG pLKO_005 502 CDS 100% 6.000 4.200 N Pla2g16 n/a
7 TRCN0000077660 CATGTCTGCTTTGACTGACAA pLKO.1 305 CDS 100% 4.950 3.465 N Pla2g16 n/a
8 TRCN0000077658 CCATCTATGTTGGTGATGGAT pLKO.1 229 CDS 100% 0.300 0.210 N Pla2g16 n/a
9 TRCN0000077659 GAGCACTTTGTGAATGAACTA pLKO.1 495 CDS 100% 4.950 2.970 N Pla2g16 n/a
10 TRCN0000156274 CCTGGAGACCTGATTGAGATT pLKO.1 183 CDS 100% 4.950 2.475 Y PLAAT3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_139269.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.