Transcript: Human NM_139285.4

Homo sapiens growth arrest specific 2 like 2 (GAS2L2), mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
GAS2L2 (246176)
Length:
3375
CDS:
390..3032

Additional Resources:

NCBI RefSeq record:
NM_139285.4
NBCI Gene record:
GAS2L2 (246176)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_139285.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000156240 CCACCAAAGGGATATCAGCAA pLKO.1 1726 CDS 100% 2.640 3.696 N GAS2L2 n/a
2 TRCN0000417383 GGAGTGGGTCAGAAGACAAAT pLKO_005 3148 3UTR 100% 13.200 9.240 N GAS2L2 n/a
3 TRCN0000421280 TGTGGACTGGAAGACATATAC pLKO_005 1349 CDS 100% 13.200 9.240 N GAS2L2 n/a
4 TRCN0000417727 CAACCTCACTGGCTTAATCAA pLKO_005 2976 CDS 100% 5.625 3.938 N GAS2L2 n/a
5 TRCN0000156184 CTTCATCCAGTGGTGTCGAAA pLKO.1 737 CDS 100% 4.950 3.465 N GAS2L2 n/a
6 TRCN0000156090 CAAGCCATCTACTGTAGCCTT pLKO.1 2181 CDS 100% 2.640 1.848 N GAS2L2 n/a
7 TRCN0000417748 TGCAGTTCTCCATGGTCAAAG pLKO_005 1051 CDS 100% 10.800 6.480 N GAS2L2 n/a
8 TRCN0000154519 GAACCATGTGATGGTACGTGT pLKO.1 1133 CDS 100% 2.640 1.584 N GAS2L2 n/a
9 TRCN0000154416 GAGGAAGGAAAGGAGGAGAAA pLKO.1 2907 CDS 100% 4.950 2.475 Y GAS2L2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_139285.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.