Transcript: Mouse NM_139303.1

Mus musculus kinesin family member 18A (Kif18a), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Kif18a (228421)
Length:
3487
CDS:
202..2862

Additional Resources:

NCBI RefSeq record:
NM_139303.1
NBCI Gene record:
Kif18a (228421)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_139303.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000340810 ACGCATTCGACGGGATAATTC pLKO_005 2721 CDS 100% 13.200 18.480 N Kif18a n/a
2 TRCN0000091623 CCTTCCATAAATAATGTGCTA pLKO.1 3309 3UTR 100% 2.640 3.696 N Kif18a n/a
3 TRCN0000340808 AGACTGAAAGTGGGCTATAAA pLKO_005 2767 CDS 100% 15.000 12.000 N Kif18a n/a
4 TRCN0000091626 GCTGACCAAACTAATGAACAT pLKO.1 2050 CDS 100% 4.950 3.960 N Kif18a n/a
5 TRCN0000091624 CGATTTGTAGAAGGCACAAAT pLKO.1 1021 CDS 100% 1.320 1.056 N Kif18a n/a
6 TRCN0000352533 GTCACCATGATGCCAATTTAC pLKO_005 3054 3UTR 100% 13.200 9.240 N Kif18a n/a
7 TRCN0000352534 GTGGTTCATGTAGTGGATAAA pLKO_005 298 CDS 100% 13.200 9.240 N Kif18a n/a
8 TRCN0000340807 TACTCTACACCAGCCTAAATC pLKO_005 777 CDS 100% 13.200 9.240 N Kif18a n/a
9 TRCN0000091625 CCCAGAAAGCACTGTGTAGAA pLKO.1 2405 CDS 100% 4.950 3.465 N Kif18a n/a
10 TRCN0000091627 CCTCCAGAACAAAGAACTGAA pLKO.1 1827 CDS 100% 4.950 3.465 N Kif18a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_139303.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.