Transcript: Mouse NM_144520.2

Mus musculus SEC14-like lipid binding 2 (Sec14l2), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Sec14l2 (67815)
Length:
2529
CDS:
52..1263

Additional Resources:

NCBI RefSeq record:
NM_144520.2
NBCI Gene record:
Sec14l2 (67815)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_144520.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000102081 CCAGAGATACAATTCCCACAT pLKO.1 1068 CDS 100% 4.050 5.670 N Sec14l2 n/a
2 TRCN0000308939 CCAGAGATACAATTCCCACAT pLKO_005 1068 CDS 100% 4.050 5.670 N Sec14l2 n/a
3 TRCN0000102080 CCCTACACAAAGATGACAATT pLKO.1 1976 3UTR 100% 13.200 9.240 N Sec14l2 n/a
4 TRCN0000331900 CCCTACACAAAGATGACAATT pLKO_005 1976 3UTR 100% 13.200 9.240 N Sec14l2 n/a
5 TRCN0000019589 CCAGAGGTGATCCAACAGTAT pLKO.1 280 CDS 100% 4.950 3.465 N SEC14L2 n/a
6 TRCN0000102083 CCATGCCAAGAAAGTCAGTTT pLKO.1 1167 CDS 100% 4.950 3.465 N Sec14l2 n/a
7 TRCN0000309004 CCATGCCAAGAAAGTCAGTTT pLKO_005 1167 CDS 100% 4.950 3.465 N Sec14l2 n/a
8 TRCN0000102082 CCAGATGACTACTTCCTCCTT pLKO.1 148 CDS 100% 2.640 1.848 N Sec14l2 n/a
9 TRCN0000308938 CCAGATGACTACTTCCTCCTT pLKO_005 148 CDS 100% 2.640 1.848 N Sec14l2 n/a
10 TRCN0000102084 CTATAACCTCATCAAGCCCTT pLKO.1 654 CDS 100% 2.160 1.512 N Sec14l2 n/a
11 TRCN0000309003 CTATAACCTCATCAAGCCCTT pLKO_005 654 CDS 100% 2.160 1.512 N Sec14l2 n/a
12 TRCN0000019592 GTGGCCTATAACCTCATCAAA pLKO.1 649 CDS 100% 5.625 3.938 N SEC14L2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_144520.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.